View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16950_high_33 (Length: 208)

Name: NF16950_high_33
Description: NF16950
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16950_high_33
NF16950_high_33
[»] chr1 (1 HSPs)
chr1 (13-190)||(3843758-3843935)


Alignment Details
Target: chr1 (Bit Score: 178; Significance: 3e-96; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 178; E-Value: 3e-96
Query Start/End: Original strand, 13 - 190
Target Start/End: Complemental strand, 3843935 - 3843758
Alignment:
13 aatactaaacatataggtgccataaagtaccaacaaactgatataaacaaggtacaaccgcagtgtgatgaaacagctgaggttaccatacgaccaatag 112  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3843935 aatactaaacatataggtgccataaagtaccaacaaactgatataaacaaggtacaaccgcagtgtgatgaaacagctgaggttaccatacgaccaatag 3843836  T
113 atagatggtgaagtatatgggaaatggggtcccattttggcttattaaccttttctagttcaacacaagtgcaatatc 190  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3843835 atagatggtgaagtatatgggaaatggggtcccattttggcttattaaccttttctagttcaacacaagtgcaatatc 3843758  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University