View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16950_low_13 (Length: 389)
Name: NF16950_low_13
Description: NF16950
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16950_low_13 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 312; Significance: 1e-176; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 312; E-Value: 1e-176
Query Start/End: Original strand, 18 - 376
Target Start/End: Original strand, 7413946 - 7414305
Alignment:
| Q |
18 |
tttctgttgtcatgatggt-agaatatggctttttattgcattccttttactagatttatagtttgaagtcagatcttagtacttcttggccagatgttg |
116 |
Q |
| |
|
||||||||||||| ||||| |||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
7413946 |
tttctgttgtcatcatggttagaatatgactttttattgcattccttttactagatttatagtttgaagtgagatcttagtacttcttggccagatgttg |
7414045 |
T |
|
| Q |
117 |
gtggcacttatgatagtttctgtcagagaccatgggaaaagcatggaatttgcacaccattcagccagtatgattactttcgccacaccttatatctatg |
216 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||| |
|
|
| T |
7414046 |
gtggcacttgtgatagtttctgtcagagaccatgggaaaagcatggaatttgcacaccattcagccagtatgattacttttgtcacaccttatatctatg |
7414145 |
T |
|
| Q |
217 |
gtatactcacaatgtcacagttatggtggatgagaaaaatatcagacccgggacacctatgattaccaatcgatcaacacaaatataaaaaccaagattg |
316 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7414146 |
gtatattcacaatgtcacagttatggtggatgagaaaaatatcaaacccgggacacctatgattaccaatcgatcaacacaaatataaaaaccaagattg |
7414245 |
T |
|
| Q |
317 |
gcttcaacttagatattacttgtgcaaaaggccaatagctactaagttcgtgtcaagttc |
376 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
7414246 |
gcttcaacttacatattacttgtgcaaaaggccaatagctactaagtttgtgtcaagttc |
7414305 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University