View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16950_low_28 (Length: 273)
Name: NF16950_low_28
Description: NF16950
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16950_low_28 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 108; Significance: 3e-54; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 23 - 138
Target Start/End: Original strand, 39330399 - 39330514
Alignment:
| Q |
23 |
ggttttcaaaagtgaaattgatattatcctatcgagttgagtttaatcaaatcaaagaattggagctttagggttgtttgaatctattttatggcagtag |
122 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39330399 |
ggttttcaaaagtgaaattgatattatcctatcgagtagagtttaatcaaatcaaagaattggagctttagggttgtttgaatctattttatggcagtag |
39330498 |
T |
|
| Q |
123 |
gaattgtagtgtccct |
138 |
Q |
| |
|
||||||||||| |||| |
|
|
| T |
39330499 |
gaattgtagtggccct |
39330514 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 192 - 262
Target Start/End: Original strand, 39330565 - 39330635
Alignment:
| Q |
192 |
gcgtccctgttcgaattaaatatggatcctacttatgtaatacacaatggctattattgatttcaacctat |
262 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||| | |||||||||||| |
|
|
| T |
39330565 |
gcgtccctgttcgaattaaatatggatcctactgatgtaatacacaatggctattacttatttcaacctat |
39330635 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University