View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16951_high_8 (Length: 329)
Name: NF16951_high_8
Description: NF16951
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16951_high_8 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 303; Significance: 1e-170; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 303; E-Value: 1e-170
Query Start/End: Original strand, 6 - 329
Target Start/End: Original strand, 3306528 - 3306851
Alignment:
| Q |
6 |
atttgtaagggtggcgaagaaatctttttcgttgtatcactctcaataagggtaagattcaattttaaccaactatataaggctttgatgaaaccctttt |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3306528 |
atttgtaagggtggcgaagaaatctttttcgttgtatcactctcaataagggtaagattcaattttaaccaactatataaggctttgatgaaaccctttt |
3306627 |
T |
 |
| Q |
106 |
gattttttatcaacttttcaaactgtgattccaactcttgcataacattcaataactgatatgttctatcatgatggtgttcgcttgtttccgtaggaaa |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3306628 |
gattttttatcaacttttcaaactgtgattccaactcttgcataacattcaataactgatatgttctatcatgatggtgttcgcttgtttccgtaggaaa |
3306727 |
T |
 |
| Q |
206 |
ctgagaatctagtgatttcaataacttcatgatacttaactgcttcttgtggtgagaatgcatggttctccacattttggccatcctgtgtagcatnnnn |
305 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3306728 |
ctgagaatctagtgatttcaataacttcatgatacttaactgcttcttgtggtgagaatgcatggttctccacattttggccatcctgtgtagcataaaa |
3306827 |
T |
 |
| Q |
306 |
nnncaccattagtcttgtattcat |
329 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
3306828 |
aaacaccattagtcttgtattcat |
3306851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University