View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16952_high_12 (Length: 236)
Name: NF16952_high_12
Description: NF16952
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16952_high_12 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 159; Significance: 8e-85; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 159; E-Value: 8e-85
Query Start/End: Original strand, 3 - 221
Target Start/End: Complemental strand, 28582338 - 28582120
Alignment:
| Q |
3 |
atatagaaccatgattactaatttacgatggtaattggtcacggttaatgctaaccctttttctattttatcatttgaagatattaagcaatgggaagta |
102 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||| |||||||| |||| |||||| ||||||||||||| || |
|
|
| T |
28582338 |
atatagaaccatgattactaatttacaatggtaattggtaacggttaatgctaaccctttttatattttattattttaagatactaagcaatgggaaata |
28582239 |
T |
|
| Q |
103 |
taagagttctgaacaccgagtcatgataacttccaaccaatccagagtatcagttccattgttcactctacccagatttacagagaggattggcccatta |
202 |
Q |
| |
|
||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||| |||||||||| ||||||||||| ||||||||||||| |
|
|
| T |
28582238 |
caagagttctgaacaccgagtcatgacaacttcgaaccaatccagagtatcagttccattgtttactctacccaaatttacagagaagattggcccatta |
28582139 |
T |
|
| Q |
203 |
caagaattggtgaagaaag |
221 |
Q |
| |
|
| |||||| |||||||||| |
|
|
| T |
28582138 |
ccagaattagtgaagaaag |
28582120 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University