View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16952_low_14 (Length: 216)
Name: NF16952_low_14
Description: NF16952
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16952_low_14 |
 |  |
|
| [»] scaffold0028 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0028 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: scaffold0028
Description:
Target: scaffold0028; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 16 - 200
Target Start/End: Original strand, 110624 - 110806
Alignment:
| Q |
16 |
atgaaatcctgtgttcaattgataaagcaagatgcgatggaaatcattgtaagttttgaattattctccctttcaagtcatcgacttagaggtcagttac |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
110624 |
atgaaatcctgtgttcaattgataaagcaagatgcgatggaaatctttgtaagttttgaattattctccctttcaagtcatcgacttagaggtcagttac |
110723 |
T |
 |
| Q |
116 |
atgctatactgcttttgtgttgagaaactataagtgtatgctgaaatcggtttgtgtgattctatgatttctttattttgataat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
110724 |
atgctatactgcttttgtgttgagaaactataagtgtatgctgaaatcggttggtgtgattctatgatt--tttattttgataat |
110806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University