View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16953_low_6 (Length: 320)
Name: NF16953_low_6
Description: NF16953
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16953_low_6 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 258; Significance: 1e-143; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 258; E-Value: 1e-143
Query Start/End: Original strand, 19 - 303
Target Start/End: Original strand, 42825575 - 42825860
Alignment:
| Q |
19 |
taccctttttatttgtcctagtgtcatattatagtaataaatgtatatttttattattgaggggttcatatggatatagataaatgatataaatgtttta |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
42825575 |
taccctttttatttgtcctagtgtcatattatagtaataaatgtatatttttattattgaggggttcatatggatatagataaatcatataaatgtttta |
42825674 |
T |
|
| Q |
119 |
ctcgggtcatttgtatgtatgtatcatcaaaactttgaatatgtcaacatgaacagtttgatagtaa-ttttataatcagtgttgcataacaccggcgta |
217 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
42825675 |
ctcgggtcatttgtatgtatgtatcatcagaactttgaatatgtcaacatgaacagtttgatagtaatttttataatcagtgttgcataacaccggcgta |
42825774 |
T |
|
| Q |
218 |
ggatgcactcagagaaggccaacgccaatatggttccaaaattccaaattacttcactgttatgcttttcaggattcaatggtgag |
303 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
42825775 |
ggatgcattcagagaaggccaacgccaatatggttccaaaattccaaattacttcactgttctgcttttcaggattcaacggtgag |
42825860 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University