View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16954_high_11 (Length: 242)
Name: NF16954_high_11
Description: NF16954
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16954_high_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 232
Target Start/End: Original strand, 33718714 - 33718957
Alignment:
| Q |
1 |
taaaagatgctagccttgaaagtaattatcacaagcaacaaattgcttgatattggttagtcaatagttagacccagt------------gcgataaata |
88 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||| ||||| |||||||||| |
|
|
| T |
33718714 |
taaaagatgctagccttgaaagtaattatcacaagcaacaaattgcttgacattgattagtcaatagttagagccagttagttagagtctgcgataaata |
33718813 |
T |
 |
| Q |
89 |
acaggatagaaataacagacgacaaagaaacgagatgattcttggaccttgaagaggagattgggagggaaagcctaggtctttcaaatacttggagtag |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33718814 |
acaggatagaaataacagacgacaaagaaacgagatgattcttggaccttgaagaggagattgggagggaaagcctaggtctttcaaatacttggagtag |
33718913 |
T |
 |
| Q |
189 |
ggactacatttaaggggttgatatctcaacatatgttttttcat |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33718914 |
ggactacatttaaggggttgatatctcaacatatgttttttcat |
33718957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University