View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16955_low_13 (Length: 239)
Name: NF16955_low_13
Description: NF16955
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16955_low_13 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 11 - 225
Target Start/End: Original strand, 10083424 - 10083638
Alignment:
| Q |
11 |
taattctagacacttgtgatttttagagaataaaatcaattaaaaatgtttgacaatttatgtcgtgatgtcgaggtttttgatgtctctacaatcattg |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
10083424 |
taattctagacacttgtgatttttagagaataaaatcaattaaaaatgtttgacaatttatgtcgtgatgtcaaggtttttgatgtctctacaatcattg |
10083523 |
T |
 |
| Q |
111 |
tgatttcgattaagtgttgtttaacgccgattcttctctatataatttatatgacacagccaccaccatagccgcgacaactattaaaaccttcgtaaaa |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
10083524 |
tgatttcgattaagtgttgtttaacgccgattcttctctatataatttatatgacacagccaccaccatagccgtgacaactattaaaaccttcgtaaaa |
10083623 |
T |
 |
| Q |
211 |
tctaattgatgaaac |
225 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
10083624 |
tctaattgatgaaac |
10083638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University