View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16956_high_7 (Length: 402)
Name: NF16956_high_7
Description: NF16956
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16956_high_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 11 - 321
Target Start/End: Original strand, 39908346 - 39908657
Alignment:
| Q |
11 |
caaagggctagttgtttggtatcaagcctacactattggttgtgcttagcaactaattgcgattagtatataatcaaattgttagagaccaacctgtata |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39908346 |
caaagggctagttgtttggtatcaagcctacactattggttgtgcttagcaactaattgtgattagtatataatcaaattgttagagaccaacctgtata |
39908445 |
T |
 |
| Q |
111 |
acnnnnnnntagggaacaagatctcatgccgttgannnnnnncataggtgttttgttcctaattgttttcttctttatttcaaggtgtgaaacaaacaca |
210 |
Q |
| |
|
|| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39908446 |
acaaaaaaatagggaacaagatctcatgccgttgatttttttcataggtgttttgttcctaattgttttcttctttatttcaaggtgtgaaacaaacaca |
39908545 |
T |
 |
| Q |
211 |
taaacatgatacgtgtcaatgaagctacacatgttcttcttcttgattggttttcaaaacatcatt-aannnnnnnnatcatatggttttctatttgaac |
309 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
39908546 |
taaacatgatacgtgtcaatgaagctacacatgttcttcttcttgattggttttcaaaacatcattaaattttttttatcatatggttttctatttgaac |
39908645 |
T |
 |
| Q |
310 |
gatgccgtggtc |
321 |
Q |
| |
|
|||||||||||| |
|
|
| T |
39908646 |
gatgccgtggtc |
39908657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University