View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16956_low_19 (Length: 267)
Name: NF16956_low_19
Description: NF16956
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16956_low_19 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 94; Significance: 6e-46; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 94; E-Value: 6e-46
Query Start/End: Original strand, 17 - 150
Target Start/End: Original strand, 17192046 - 17192179
Alignment:
| Q |
17 |
cttatcgaccgtacaatcatccgctcgaatgaatctaccaaactgtgacacacagatcttgaaaaacatttcgttccaagcatgtaaaggagtaccatat |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||| ||||| ||||||||||||||||| |||||||||||||||||||||||| | |
|
|
| T |
17192046 |
cttatcgaccgtacaatcatccgctcgaatgaatctaccacactgtgaaacacaaatcttgaaaaacatttcattccaagcatgtaaaggagtaccacaa |
17192145 |
T |
 |
| Q |
117 |
atccgcaaacaaggacctcgttcaaaaattgcat |
150 |
Q |
| |
|
|||| ||| |||| ||| |||||||||||||||| |
|
|
| T |
17192146 |
atccacaaccaagcaccacgttcaaaaattgcat |
17192179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 68; Significance: 2e-30; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 164 - 247
Target Start/End: Complemental strand, 17236383 - 17236301
Alignment:
| Q |
164 |
cacgcaatatttcatgaatggttttcaaattcaaagaggaaacacccattcaagtattcgcaccaagaaaagatacccattcca |
247 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
17236383 |
cacgcaatattttatgaatggttttcaaattcaaagaggaa-cacccattcaagtattcgcaccaagaaaagatagccattcca |
17236301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University