View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16956_low_25 (Length: 241)
Name: NF16956_low_25
Description: NF16956
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16956_low_25 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 141; Significance: 5e-74; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 141; E-Value: 5e-74
Query Start/End: Original strand, 9 - 164
Target Start/End: Original strand, 32496961 - 32497117
Alignment:
| Q |
9 |
gagatgaattgaatgagaagtggctctgcagttggagaaagtagtggagttcattgttgttcgtcacgcaacaacgttgttgttacggagagaagtagaa |
108 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
32496961 |
gagaggaattgaatgagaagtggctctgcagttggagaaagtagtggagttcattgttgttcgacacgcaacaacgttgttgttacggagagaagtagaa |
32497060 |
T |
 |
| Q |
109 |
gatgatgatg-ttttttgctgcggttttggtttcactctatgtttgtgttttcataa |
164 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32497061 |
gatgatgatgtttttttgctgcggttttggtttcactctatgtttgtgttttcataa |
32497117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University