View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16956_low_26 (Length: 237)
Name: NF16956_low_26
Description: NF16956
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16956_low_26 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 16 - 237
Target Start/End: Original strand, 36534367 - 36534588
Alignment:
| Q |
16 |
cagcaggaggagcagcaggaggaggttcagccgcagagggagagacggtggttgattttcttgaagaaatgaagaatgcctgtaaagctgctcaacctag |
115 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36534367 |
cagcaggaggaggagcaggaggaggttcagccgcagagggagagacggtggttgattttcttgaagaaatgaagaatgcctgtaaagctgctcaacctaa |
36534466 |
T |
 |
| Q |
116 |
attgaaagttcgtacaatgaaggttgaaatagataatggaaaagatagggctaacactattctcttacataccttagatcaaggggttgatgttgtagtt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
36534467 |
attgaaagttcgtacaatgaaggttgaaatagataatggaaaagatagggctaacactattctcttacataccttagatcaacgggttgatgttgtagtt |
36534566 |
T |
 |
| Q |
216 |
ataggccaaaaacgcactcttt |
237 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
36534567 |
ataggccaaaaacgcactcttt |
36534588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University