View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16956_low_27 (Length: 205)
Name: NF16956_low_27
Description: NF16956
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16956_low_27 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 17 - 189
Target Start/End: Complemental strand, 8209745 - 8209573
Alignment:
| Q |
17 |
aaaatgttatagtaactttgtagtttgtttgttatctcaatttatcataatttattattatttcaaaagtttaatgagccgtttcctctaaaaaatatga |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||| || |
|
|
| T |
8209745 |
aaaatgttatagtaactttgtagtttgtttgttatctcaatttgtcataatttattattatttcaaaagtttaatgagccgtttcccctaaaaaataaga |
8209646 |
T |
 |
| Q |
117 |
aagaattttaatgagtccgttataatgttgcactcttcgcggcacaaataaaaaacgataccaacctctctct |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8209645 |
aagaattttaatgagtccgttataatgttgcactcttcgcggcacaaataaaaaacgataccaacctctctct |
8209573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University