View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16957_high_2 (Length: 239)
Name: NF16957_high_2
Description: NF16957
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16957_high_2 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 217
Target Start/End: Complemental strand, 33718637 - 33718421
Alignment:
| Q |
1 |
cttgccttttgtagcttaggatcttattcctcgcagcctttctgatatattagttgtgttcttgtcaacattgtaatctaggtctctttctcttgtttct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33718637 |
cttgccttttgtagcttaggatcttattcctcgcagcctttctgatatattagttgtgttcttgtcaacattgtaatctaggtctctttctcttgtttct |
33718538 |
T |
 |
| Q |
101 |
gttattaaaagattgaaatgtgtaagataagttcttacgataatcttttcctcgagaacatttactataatgcgaagtgaacaaaggaagtgaatttagt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
33718537 |
gttattaaaagattgaaatgtgtaagataagttcttacgataatcttttcctcgagagcatttactataatgcgaagtgaacaaaggaagtgaatgtagt |
33718438 |
T |
 |
| Q |
201 |
aggttttggataccaat |
217 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
33718437 |
aggttttggataccaat |
33718421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University