View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16958_high_16 (Length: 255)
Name: NF16958_high_16
Description: NF16958
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16958_high_16 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 84 - 218
Target Start/End: Complemental strand, 16895004 - 16894870
Alignment:
| Q |
84 |
taagagagaaacatgtctaacatttataatttctagtgtccttttccaaatttttagtctctactctctttcaaaaagatctccttcgcagccctcatgc |
183 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16895004 |
taagagagaaacatgtctaacatttataatttctagtgtccttttccaaatttttagtctctactctctttcaaaaagatctccttcgcagccctcatgc |
16894905 |
T |
|
| Q |
184 |
aaacgatgcgcagccttcataatgaaaccagagcc |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
16894904 |
aaacgatgcgcagccttcataatgaaaccagagcc |
16894870 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University