View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16958_high_17 (Length: 252)
Name: NF16958_high_17
Description: NF16958
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16958_high_17 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 44 - 239
Target Start/End: Complemental strand, 5441577 - 5441382
Alignment:
| Q |
44 |
aaattgttattgttggctgaaaggaatgtgaatgtcacatattcatcaagtgtaataccatacaataactatgaacatatctataaagttgatagaatgg |
143 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5441577 |
aaattattattgttggctgaaaggaatgtgaatgtcacatattcatcaagtgtaataccatacaataactatgaacatatctataaagttgatagaatgg |
5441478 |
T |
|
| Q |
144 |
gtaacctcccatacctgatccaaatgaacatcactatgtagttacaacttgagaagattgatagcattcaatttgtgagtcattatctatttgcct |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
5441477 |
gtaacctcccatacctgatccaaatgaacatcaatatgtagttacaacttgagaagatagatagcattcaatttatgagtcattatctatttgcct |
5441382 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University