View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16958_high_25 (Length: 215)
Name: NF16958_high_25
Description: NF16958
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16958_high_25 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 150; Significance: 2e-79; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 13 - 194
Target Start/End: Complemental strand, 6956122 - 6955941
Alignment:
| Q |
13 |
agatgaagcatttttggtgcaacaagtttttgaccttataccaccacccatgacgtaaacatgttccacatttttctttaggtgtggattattcataagg |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6956122 |
agatgaagcatttttggtgcaacaagtttttgaccttataacaccacccatgatgtaaacatgttccacatttttctttaggtgtggattattcataagg |
6956023 |
T |
|
| Q |
113 |
aaaatggctaaatttgtatgagttccaattgcaatcagagttataggacctgcagatattttgtcaatcagaacttgctgag |
194 |
Q |
| |
|
|||||||||||||||||||| | ||| | ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6956022 |
aaaatggctaaatttgtatgcgcgccagtcacaatcagagttataggacctgcagatattttgtcaatcagaacttgctgag |
6955941 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 124 - 198
Target Start/End: Complemental strand, 6966183 - 6966109
Alignment:
| Q |
124 |
atttgtatgagttccaattgcaatcagagttataggacctgcagatattttgtcaatcagaacttgctgagcagt |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6966183 |
atttgtatgagttccaattgcaatcagagttataggacctgcagatattttgtcaatcagaacttgctgagcagt |
6966109 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 53; Significance: 1e-21; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 42 - 198
Target Start/End: Original strand, 49115934 - 49116090
Alignment:
| Q |
42 |
ttgaccttataccaccacccatgacgtaaacatgttccacatttttctttaggtgtggattattcataaggaaaatggctaaatttgtatgagttccaat |
141 |
Q |
| |
|
||||||||| ||| |||||||| | |||| |||||||||||||||||| ||||||||||||||||| |||||||| || | ||||||||||| ||| || |
|
|
| T |
49115934 |
ttgaccttacacctccacccattatataaatatgttccacatttttcttaaggtgtggattattcattaggaaaattgcaacatttgtatgagctcccat |
49116033 |
T |
|
| Q |
142 |
tgcaatcagagttataggacctgcagatattttgtcaatcagaacttgctgagcagt |
198 |
Q |
| |
|
|| || |||| | ||||||||||| | ||| ||||||| ||||| |||||||| |
|
|
| T |
49116034 |
cataaacaaagttgtgggacctgcagacactttttcaatcaacacttgttgagcagt |
49116090 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 42 - 198
Target Start/End: Original strand, 49103636 - 49103792
Alignment:
| Q |
42 |
ttgaccttataccaccacccatgacgtaaacatgttccacatttttctttaggtgtggattattcataaggaaaatggctaaatttgtatgagttccaat |
141 |
Q |
| |
|
|||| |||| ||| |||||||| | |||| |||||||||||||||||| ||||||||||||||||| |||||||| || | ||||||||||| ||| || |
|
|
| T |
49103636 |
ttgatcttacacctccacccattatataaatatgttccacatttttcttaaggtgtggattattcattaggaaaattgcaacatttgtatgagctcccat |
49103735 |
T |
|
| Q |
142 |
tgcaatcagagttataggacctgcagatattttgtcaatcagaacttgctgagcagt |
198 |
Q |
| |
|
|| || |||| | ||||||||||| | ||| ||||||| ||||| |||||||| |
|
|
| T |
49103736 |
cataaacaaagttgtgggacctgcagacactttttcaatcaacacttgttgagcagt |
49103792 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University