View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16958_high_26 (Length: 213)
Name: NF16958_high_26
Description: NF16958
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16958_high_26 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 53; Significance: 1e-21; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 49 - 101
Target Start/End: Original strand, 51101177 - 51101229
Alignment:
| Q |
49 |
agacaacggtttaagaaattaaatagcaacagtttctgattttctaaaacacg |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51101177 |
agacaacggtttaagaaattaaatagcaacagtttctgattttctaaaacacg |
51101229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University