View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16958_low_13 (Length: 324)
Name: NF16958_low_13
Description: NF16958
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16958_low_13 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 280; Significance: 1e-157; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 280; E-Value: 1e-157
Query Start/End: Original strand, 24 - 315
Target Start/End: Complemental strand, 6863960 - 6863669
Alignment:
| Q |
24 |
ggaacagctgttcagaactgtgtagctgcagcctccatgctggaggatcatggcttgcgtgtaacggtggtggatgcacgtttctgcaagccgttggacc |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
6863960 |
ggaacagctgttcagaactgtgtagctgcagcctccatgctggaggatcatggcttgcgtgtaacggtggcggatgcacgtttctgcaagccgttggacc |
6863861 |
T |
|
| Q |
124 |
attcgctcattcgcagcctagccaaatcacacgaggttttgatcactgtggaagaaggatcaataggaggatttggttctcatgttgctcagttcatggc |
223 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6863860 |
attcactcattcgcagcctagccaaatcacacgaggttttgatcactgtggaagaaggatcaataggaggatttggttctcatgttgctcagttcatggc |
6863761 |
T |
|
| Q |
224 |
ccttgatggtcttcttgatggaaaattgaaggtatgaatccttttcttttttaatttggcctaaattatttggatttcttatgtagtataat |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
6863760 |
ccttgatggtcttcttgatggaaaattgaaggtatgaatccttttcttttttaatttggcctaaattatttgcatttcttatgtagtataat |
6863669 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 90; Significance: 2e-43; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 96 - 257
Target Start/End: Original strand, 49148608 - 49148769
Alignment:
| Q |
96 |
gatgcacgtttctgcaagccgttggaccattcgctcattcgcagcctagccaaatcacacgaggttttgatcactgtggaagaaggatcaataggaggat |
195 |
Q |
| |
|
|||||||||||||||||||| ||||| | || | |||||||| || |||||||||||||||||| ||||||| || |||||||||||||| ||||||| |
|
|
| T |
49148608 |
gatgcacgtttctgcaagccattggatcgatccttgattcgcagtctggccaaatcacacgaggttctgatcaccgtagaagaaggatcaattggaggat |
49148707 |
T |
|
| Q |
196 |
ttggttctcatgttgctcagttcatggcccttgatggtcttcttgatggaaaattgaaggta |
257 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| || | |||||||| ||||||||| |
|
|
| T |
49148708 |
ttggttctcatgttgctcagttcatggcccttgatggcctcttagatggaaatttgaaggta |
49148769 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 177 - 238
Target Start/End: Complemental strand, 49712716 - 49712655
Alignment:
| Q |
177 |
gaaggatcaataggaggatttggttctcatgttgctcagttcatggcccttgatggtcttct |
238 |
Q |
| |
|
|||||||| || |||||||||||||| ||||||||||| || || || |||||||| ||||| |
|
|
| T |
49712716 |
gaaggatctattggaggatttggttcccatgttgctcaatttattgctcttgatggacttct |
49712655 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University