View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16958_low_18 (Length: 251)
Name: NF16958_low_18
Description: NF16958
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16958_low_18 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 1 - 238
Target Start/End: Complemental strand, 51100998 - 51100761
Alignment:
| Q |
1 |
ttgggaagaagcagaataagaagaagttgcatagtggagaaggagtgagacttggaaaatatgagttgggtaggattcttggtgagggcaattttggtaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51100998 |
ttgggaagaagcagaataagaagaagttgcatagtggagaaggagtgagacttggaaaatatgagttgggtaggattcttggtgagggcaattttggtaa |
51100899 |
T |
|
| Q |
101 |
agttaagtttgctaggaacactgattctggacaaccttatgctattaagattattgataagaaaaagatcattgatctcaatatcacaaaccaggtttgt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
51100898 |
agttaagtttgctaggaacactgattctggacaaccttatgctattaagattattgataagaacaagatcattgatctcaatatcacaaaccaggtttgt |
51100799 |
T |
|
| Q |
201 |
ttcaaatgccttttctctttctcattcgatcgtctcct |
238 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
51100798 |
ttcaaatgtcttttctctttctcattcgatcgtctcct |
51100761 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University