View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16958_low_22 (Length: 240)
Name: NF16958_low_22
Description: NF16958
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16958_low_22 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 201; Significance: 1e-110; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 32194523 - 32194743
Alignment:
| Q |
1 |
aaattcaagattcatggacacaagccacttgagagattgcaacagcccccacgcttccccttccaccgccgtcatagttgaaggaatccacatagagtat |
100 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
32194523 |
aaattcaagattcaaggacacaagccacttgagagattgcaacagcccccatgcttccccttccaccgccgtcatagttgaaggaatccacatagagttt |
32194622 |
T |
|
| Q |
101 |
gctggtgttaaacggcatgcactatcatgcacacatgctcccataccaactccattttgggcagaaactatagcaacatctgagttgcattggacataac |
200 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32194623 |
gctggtgttaaacggcctgcactatcatgcacacatgctcccataccaactccgttttgggcagaaactatagcaacatctgagttgcattggacataac |
32194722 |
T |
|
| Q |
201 |
cgtgagacagaggcaaccagt |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
32194723 |
cgtgagacagaggcaaccagt |
32194743 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 5 - 57
Target Start/End: Original strand, 32186818 - 32186870
Alignment:
| Q |
5 |
tcaagattcatggacacaagccacttgagagattgcaacagcccccacgcttc |
57 |
Q |
| |
|
||||||||||| |||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
32186818 |
tcaagattcattgacataagccacttgagagattgcaacagcccccacgcttc |
32186870 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 9 - 51
Target Start/End: Original strand, 32185886 - 32185928
Alignment:
| Q |
9 |
gattcatggacacaagccacttgagagattgcaacagccccca |
51 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
32185886 |
gattcatggacataagccacttgagagattgcaacagccccca |
32185928 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University