View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16959_low_6 (Length: 261)
Name: NF16959_low_6
Description: NF16959
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16959_low_6 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 74; Significance: 5e-34; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 9 - 102
Target Start/End: Complemental strand, 27329271 - 27329178
Alignment:
| Q |
9 |
cattcaagttgaagaagaatttacatgccacagcacttgagttcagactcttgagacaacatggttatgatatatctacaggtcattaaatcta |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||| ||||| ||||||||||||||| ||||||||||||||| |||||| |
|
|
| T |
27329271 |
cattcaagttgaagaagaatttacatgccacagcacgtgagttcagacttttgaggcaacatggttatgatttatctacaggtcattgaatcta |
27329178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 16 - 91
Target Start/End: Complemental strand, 27446773 - 27446698
Alignment:
| Q |
16 |
gttgaagaagaatttacatgccacagcacttgagttcagactcttgagacaacatggttatgatatatctacaggt |
91 |
Q |
| |
|
||||||||| || ||| |||||||| |||| ||||||||||||| || |||||||||||| |||||||||||||| |
|
|
| T |
27446773 |
gttgaagaataacttatatgccacatcactcaagttcagactcttaaggcaacatggttataatatatctacaggt |
27446698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 59; Significance: 4e-25; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 13 - 91
Target Start/End: Original strand, 18839701 - 18839779
Alignment:
| Q |
13 |
caagttgaagaagaatttacatgccacagcacttgagttcagactcttgagacaacatggttatgatatatctacaggt |
91 |
Q |
| |
|
||||||||||||||| || |||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
18839701 |
caagttgaagaagaacttgcatgccacagcactcaagttcagactcttgaggcaacatggttatgatatatctacaggt |
18839779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University