View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1696-Insertion-11 (Length: 376)
Name: NF1696-Insertion-11
Description: NF1696
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1696-Insertion-11 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 304; Significance: 1e-171; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 304; E-Value: 1e-171
Query Start/End: Original strand, 9 - 376
Target Start/End: Complemental strand, 47902672 - 47902304
Alignment:
| Q |
9 |
tcattaggtcgctggtatggattatatcacctttttgccttaatcgacattattgcatacttatatgctccaattatgaacttacagccacacacggtcc |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||| |
|
|
| T |
47902672 |
tcattaggtcgctggtatggattatatcacctttttgccttaatcgacattattgcatacttatatgctccaattatgaatttacagccacacgcggtcc |
47902573 |
T |
 |
| Q |
109 |
ctttgccaaccaaaattattcacactagagaataccaatcacccaactcaaccacaattgcacgtgttatacatagcaccttgttactcattaaaaaatt |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47902572 |
ctttgccaaccaaaattattcacactagagaataccagtcactcaactcaaccacaattgcacgtgttatacatagcaccttgttactcattaaaaaatt |
47902473 |
T |
 |
| Q |
209 |
tataagnnnnnnncataactcaattggcagagaggttgcattttatatgttggggttagagtttgaacaaattctctactaattcatctgaatggtgaat |
308 |
Q |
| |
|
|||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
47902472 |
tataagttttgttcataactcaattgatagagaggttgcattttatatgttggggttagagtttgaacaaattctctacttattcatctgaatggtgaat |
47902373 |
T |
 |
| Q |
309 |
ttacggtttatttga-caaaaaggtaaaaaattatgaactaatttgcatcgtatagtccttctacttta |
376 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
47902372 |
ttacggtttatttgataaaaaaggtaaaaaattatgaactaatttgcatcctatagtccttctacttta |
47902304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University