View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1696-Insertion-19 (Length: 179)
Name: NF1696-Insertion-19
Description: NF1696
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1696-Insertion-19 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 8 - 179
Target Start/End: Original strand, 40048582 - 40048753
Alignment:
| Q |
8 |
gttgccgtcgctgttgctgctgtgttgggagaatacaatgaggagaacatgagtagaaagagtgagaaggaaaagataatttgattcatatttggcttga |
107 |
Q |
| |
|
||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40048582 |
gttgctgtcgctgttgctgctatgttgggagaatacaatgaggagaacatgagtagaaagagtgagaaggaaaagataatttgattcatatttggcttga |
40048681 |
T |
 |
| Q |
108 |
tgattgaagattgtggaggaacgtaaatgattggattttttgttaatttgtatgttggatgtgttgattgga |
179 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40048682 |
tgattgaagattgtggaggaatgtaaatgattggattttttgttaatttgtatgttggatgtgttgattgga |
40048753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University