View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1696-Insertion-4 (Length: 242)
Name: NF1696-Insertion-4
Description: NF1696
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1696-Insertion-4 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 103; Significance: 2e-51; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 7 - 145
Target Start/End: Complemental strand, 10308244 - 10308106
Alignment:
| Q |
7 |
aaaatgttggtagtcttgcagcgaatgatgtccttatatgttgcatcccattacaagaattctccaaatgatctgcaattgatgtcagatgctccggcac |
106 |
Q |
| |
|
||||| |||||||||||||||| |||||||||||||||||| ||||| |||||||||||||||||||||||||| ||| | |||||||||||||| |||| |
|
|
| T |
10308244 |
aaaatattggtagtcttgcagcaaatgatgtccttatatgtcgcatcacattacaagaattctccaaatgatctacaacttatgtcagatgctccagcac |
10308145 |
T |
|
| Q |
107 |
accacttatttgttctacttggtatacttggttttcttt |
145 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
10308144 |
accacttatttgtgctacttggtatacttggttttcttt |
10308106 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 209 - 242
Target Start/End: Complemental strand, 10308028 - 10307995
Alignment:
| Q |
209 |
cctgttgatgaatcaaagaatcaacttcctgata |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
10308028 |
cctgttgatgaatcaaagaatcaacttcctgata |
10307995 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 86; Significance: 3e-41; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 20 - 141
Target Start/End: Complemental strand, 38430867 - 38430746
Alignment:
| Q |
20 |
tcttgcagcgaatgatgtccttatatgttgcatcccattacaagaattctccaaatgatctgcaattgatgtcagatgctccggcacaccacttatttgt |
119 |
Q |
| |
|
|||| |||||||||||| | |||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||| |
|
|
| T |
38430867 |
tcttacagcgaatgatggcattatatgttgcatcgcattacaagaattctccaaatgatctgcaattgatggcagatgctccagcacaccacttatttgt |
38430768 |
T |
|
| Q |
120 |
tctacttggtatacttggtttt |
141 |
Q |
| |
|
||||||||||| |||| |||| |
|
|
| T |
38430767 |
gctacttggtatgcttgatttt |
38430746 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University