View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1696-Insertion-6 (Length: 185)
Name: NF1696-Insertion-6
Description: NF1696
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1696-Insertion-6 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 124; Significance: 5e-64; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 124; E-Value: 5e-64
Query Start/End: Original strand, 54 - 185
Target Start/End: Original strand, 4215942 - 4216073
Alignment:
| Q |
54 |
ctcctaattatggtaatcccccagctgaaggtggtgataggccaacagctcaaatccttccatgattgaagattgtggccatgcatgcatagtttgtgta |
153 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4215942 |
ctcctaattatggtaatcccccagctgaaggtggtgatagtccaacagctcaaatccttccatgattgaagattgtggccatgcatgcatagtttgtgta |
4216041 |
T |
|
| Q |
154 |
ccattgatatctttacatttatatatgtatta |
185 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| |
|
|
| T |
4216042 |
ccattgatatctatacatttatatatgtatta |
4216073 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University