View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1696-Insertion-8 (Length: 147)
Name: NF1696-Insertion-8
Description: NF1696
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1696-Insertion-8 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 107; Significance: 5e-54; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 107; E-Value: 5e-54
Query Start/End: Original strand, 24 - 138
Target Start/End: Complemental strand, 32550874 - 32550760
Alignment:
| Q |
24 |
taagtgttttcttttccattcattcattctttttgctaaatatacgttagtgttcatattcatcactcattagattttgtttgtccttttataggatcca |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32550874 |
taagtgttttcttttccattcattcattctttttgctaaacatacgttagtgttcatattcatcactcattagattttgtttgtccttttataggatcca |
32550775 |
T |
|
| Q |
124 |
tctaaaagtgtcaaa |
138 |
Q |
| |
|
||||||| ||||||| |
|
|
| T |
32550774 |
tctaaaattgtcaaa |
32550760 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University