View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1696-Insertion-9 (Length: 119)
Name: NF1696-Insertion-9
Description: NF1696
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1696-Insertion-9 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 104; Significance: 3e-52; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 104; E-Value: 3e-52
Query Start/End: Original strand, 8 - 119
Target Start/End: Original strand, 48277588 - 48277699
Alignment:
| Q |
8 |
cctctttagatgatactataaagtatgtgagacctttgaatctacatgcagctatacccgtctaaaaccgcaagattcaatttctctaataccaaaggcc |
107 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48277588 |
cctctttagatgatactataaagtatgtgcgacctttgaatctacatgcagctgtacccgtctaaaaccgcaagattcaatttctctaataccaaaggcc |
48277687 |
T |
|
| Q |
108 |
atgtgacatgcc |
119 |
Q |
| |
|
|||||||||||| |
|
|
| T |
48277688 |
atgtgacatgcc |
48277699 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University