View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16960_high_8 (Length: 289)
Name: NF16960_high_8
Description: NF16960
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16960_high_8 |
 |  |
|
| [»] scaffold0057 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr5 (Bit Score: 151; Significance: 6e-80; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 151; E-Value: 6e-80
Query Start/End: Original strand, 80 - 279
Target Start/End: Complemental strand, 39858110 - 39857906
Alignment:
| Q |
80 |
tttatgtttaatgttgaatctgctcatgacatctatatcaagttgatacttaattgtgggacccccctctcggacc----ctgcatatgcgggagcttta |
175 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
39858110 |
tttatgtttaatgttgaatctgctcatgacatctatatcaagctgatacttaattgtgggacccccctctcggaccctgcctgcatatgcgggagcttta |
39858011 |
T |
 |
| Q |
176 |
tcaaaccgggctgccctttctctatgttgattgtttttggatcccatag-nnnnnnncccttaatgcttgtgagggtgcttaattttttgtgattcatgt |
274 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39858010 |
tcaaaccgggctgccctttctctatattgattgtttttggatcccatagttttttttcccttaatgcttgtgagggtgcttaattttttgtgattcatgt |
39857911 |
T |
 |
| Q |
275 |
ctgtg |
279 |
Q |
| |
|
||||| |
|
|
| T |
39857910 |
ctgtg |
39857906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 67 - 131
Target Start/End: Complemental strand, 39848325 - 39848261
Alignment:
| Q |
67 |
cttttacccctcatttatgtttaatgttgaatctgctcatgacatctatatcaagttgatactta |
131 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||| ||| ||||||||| ||||||||| |
|
|
| T |
39848325 |
cttttacccctcatttatgttacatgttgaatctgctcatgtcatttatatcaagctgatactta |
39848261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 1 - 42
Target Start/End: Complemental strand, 39858148 - 39858107
Alignment:
| Q |
1 |
ttcatattttatgactttttcatcactggttgttgggtttta |
42 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
39858148 |
ttcatattttatgactttttcatctctggttgttgggtttta |
39858107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 237 - 277
Target Start/End: Complemental strand, 39848124 - 39848084
Alignment:
| Q |
237 |
aatgcttgtgagggtgcttaattttttgtgattcatgtctg |
277 |
Q |
| |
|
|||||||| ||||||||||| ||||||| |||||||||||| |
|
|
| T |
39848124 |
aatgcttgcgagggtgcttagttttttgcgattcatgtctg |
39848084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 135 - 175
Target Start/End: Original strand, 9939563 - 9939603
Alignment:
| Q |
135 |
gtgggacccccctctcggaccctgcatatgcgggagcttta |
175 |
Q |
| |
|
||||||||||| ||||||||||||| ||||||||||||||| |
|
|
| T |
9939563 |
gtgggacccccttctcggaccctgcgtatgcgggagcttta |
9939603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0057 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0057
Description:
Target: scaffold0057; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 135 - 172
Target Start/End: Original strand, 43734 - 43771
Alignment:
| Q |
135 |
gtgggacccccctctcggaccctgcatatgcgggagct |
172 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||| |
|
|
| T |
43734 |
gtgggacccctttctcggaccctgcatatgcgggagct |
43771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 150 - 194
Target Start/End: Original strand, 54175156 - 54175200
Alignment:
| Q |
150 |
cggaccctgcatatgcgggagctttatcaaaccgggctgcccttt |
194 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
54175156 |
cggaccctgcatatgcgggagctttagtgcaccgggctgcccttt |
54175200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University