View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16960_high_8 (Length: 289)

Name: NF16960_high_8
Description: NF16960
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16960_high_8
NF16960_high_8
[»] chr5 (4 HSPs)
chr5 (80-279)||(39857906-39858110)
chr5 (67-131)||(39848261-39848325)
chr5 (1-42)||(39858107-39858148)
chr5 (237-277)||(39848084-39848124)
[»] chr1 (1 HSPs)
chr1 (135-175)||(9939563-9939603)
[»] scaffold0057 (1 HSPs)
scaffold0057 (135-172)||(43734-43771)
[»] chr4 (1 HSPs)
chr4 (150-194)||(54175156-54175200)


Alignment Details
Target: chr5 (Bit Score: 151; Significance: 6e-80; HSPs: 4)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 151; E-Value: 6e-80
Query Start/End: Original strand, 80 - 279
Target Start/End: Complemental strand, 39858110 - 39857906
Alignment:
80 tttatgtttaatgttgaatctgctcatgacatctatatcaagttgatacttaattgtgggacccccctctcggacc----ctgcatatgcgggagcttta 175  Q
    |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||    ||||||||||||||||||||    
39858110 tttatgtttaatgttgaatctgctcatgacatctatatcaagctgatacttaattgtgggacccccctctcggaccctgcctgcatatgcgggagcttta 39858011  T
176 tcaaaccgggctgccctttctctatgttgattgtttttggatcccatag-nnnnnnncccttaatgcttgtgagggtgcttaattttttgtgattcatgt 274  Q
    ||||||||||||||||||||||||| |||||||||||||||||||||||        |||||||||||||||||||||||||||||||||||||||||||    
39858010 tcaaaccgggctgccctttctctatattgattgtttttggatcccatagttttttttcccttaatgcttgtgagggtgcttaattttttgtgattcatgt 39857911  T
275 ctgtg 279  Q
    |||||    
39857910 ctgtg 39857906  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 67 - 131
Target Start/End: Complemental strand, 39848325 - 39848261
Alignment:
67 cttttacccctcatttatgtttaatgttgaatctgctcatgacatctatatcaagttgatactta 131  Q
    |||||||||||||||||||||  |||||||||||||||||| ||| ||||||||| |||||||||    
39848325 cttttacccctcatttatgttacatgttgaatctgctcatgtcatttatatcaagctgatactta 39848261  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 1 - 42
Target Start/End: Complemental strand, 39858148 - 39858107
Alignment:
1 ttcatattttatgactttttcatcactggttgttgggtttta 42  Q
    |||||||||||||||||||||||| |||||||||||||||||    
39858148 ttcatattttatgactttttcatctctggttgttgggtttta 39858107  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 237 - 277
Target Start/End: Complemental strand, 39848124 - 39848084
Alignment:
237 aatgcttgtgagggtgcttaattttttgtgattcatgtctg 277  Q
    |||||||| ||||||||||| ||||||| ||||||||||||    
39848124 aatgcttgcgagggtgcttagttttttgcgattcatgtctg 39848084  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 135 - 175
Target Start/End: Original strand, 9939563 - 9939603
Alignment:
135 gtgggacccccctctcggaccctgcatatgcgggagcttta 175  Q
    ||||||||||| ||||||||||||| |||||||||||||||    
9939563 gtgggacccccttctcggaccctgcgtatgcgggagcttta 9939603  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0057 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0057
Description:

Target: scaffold0057; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 135 - 172
Target Start/End: Original strand, 43734 - 43771
Alignment:
135 gtgggacccccctctcggaccctgcatatgcgggagct 172  Q
    ||||||||||  ||||||||||||||||||||||||||    
43734 gtgggacccctttctcggaccctgcatatgcgggagct 43771  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 150 - 194
Target Start/End: Original strand, 54175156 - 54175200
Alignment:
150 cggaccctgcatatgcgggagctttatcaaaccgggctgcccttt 194  Q
    ||||||||||||||||||||||||||    |||||||||||||||    
54175156 cggaccctgcatatgcgggagctttagtgcaccgggctgcccttt 54175200  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University