View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16961_high_4 (Length: 356)

Name: NF16961_high_4
Description: NF16961
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16961_high_4
NF16961_high_4
[»] chr6 (1 HSPs)
chr6 (114-238)||(893309-893434)
[»] scaffold0179 (1 HSPs)
scaffold0179 (97-205)||(23974-24082)
[»] chr1 (1 HSPs)
chr1 (145-197)||(51092895-51092947)


Alignment Details
Target: chr6 (Bit Score: 97; Significance: 1e-47; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 114 - 238
Target Start/End: Original strand, 893309 - 893434
Alignment:
114 ggtacatgtcaactgctatttcactgttggctggccttgcgccggcctgatgcaccgtttccatcacaacctttactctcttttctaccgtc-nnnnnnn 212  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||            
893309 ggtacatgtcaactgctatttcactgttggctggccttgcgccggcctgatgcaccgtttccatcacaacctttactctcttttctaccgtctttttttt 893408  T
213 attgtagcggctctcatccgtacttc 238  Q
    ||||||||||||||||||||||||||    
893409 attgtagcggctctcatccgtacttc 893434  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0179 (Bit Score: 77; Significance: 1e-35; HSPs: 1)
Name: scaffold0179
Description:

Target: scaffold0179; HSP #1
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 97 - 205
Target Start/End: Complemental strand, 24082 - 23974
Alignment:
97 ggtcctgcctacaccatggtacatgtcaactgctatttcactgttggctggccttgcgccggcctgatgcaccgtttccatcacaacctttactctcttt 196  Q
    |||||||||||||||||||||||||||||||||| ||||||| || | |||||||||| |||  ||||||||||||||||||||||||||||||||||||    
24082 ggtcctgcctacaccatggtacatgtcaactgctctttcactttttgttggccttgcgtcggtttgatgcaccgtttccatcacaacctttactctcttt 23983  T
197 tctaccgtc 205  Q
    ||| |||||    
23982 tctcccgtc 23974  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 37; Significance: 0.000000000008; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 145 - 197
Target Start/End: Complemental strand, 51092947 - 51092895
Alignment:
145 tggccttgcgccggcctgatgcaccgtttccatcacaacctttactctctttt 197  Q
    |||||| ||||||||||||||||| ||||||||||||||||||  ||||||||    
51092947 tggcctcgcgccggcctgatgcactgtttccatcacaacctttcatctctttt 51092895  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University