View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16961_low_8 (Length: 252)
Name: NF16961_low_8
Description: NF16961
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16961_low_8 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 186; Significance: 1e-101; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 12 - 235
Target Start/End: Original strand, 299235 - 299457
Alignment:
| Q |
12 |
atgaagttttgtttggaatatttttatttgttgaagactaatgcctgggttaatttaggtacatgtacaaatgttttagatggattactaactggtttcc |
111 |
Q |
| |
|
||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
299235 |
atgaagttttgtttggaatatttttatctgctgaagactaatgcctgggttaatttaggtacatgtacaaatgttttagatggattactaactggtttcc |
299334 |
T |
 |
| Q |
112 |
cctttcctttcaacagcttcagatttttctgtggggcaatttcagtttttgnnnnnnntcacttttggttcatgggcacttgaattatcagtatgttgtt |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
299335 |
cctttcctttcaacagcttcagatttttctgtggcgcaatttcagtttttg-aaaaaatcacttttggttcatgggcacttgaattatcagtatgttgtt |
299433 |
T |
 |
| Q |
212 |
tatttagttttgtataatttagct |
235 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
299434 |
tatttagttttgtataatttagct |
299457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 18 - 127
Target Start/End: Original strand, 301405 - 301514
Alignment:
| Q |
18 |
ttttgtttggaatatttttatttgttg-aagactaatgcctgggttaatttaggtacatgtacaaatgttttagatggattactaactggtttccccttt |
116 |
Q |
| |
|
||||||||| ||||||||||| | ||| || |||||||| ||||||||||| ||| ||| | ||| |||||||||| || |||||||| |||| || | | |
|
|
| T |
301405 |
ttttgtttgaaatatttttatattttggaaaactaatgcttgggttaattt-ggtgcatattcaactgttttagattgaatactaactagtttaccatct |
301503 |
T |
 |
| Q |
117 |
cctttcaacag |
127 |
Q |
| |
|
||||||||||| |
|
|
| T |
301504 |
cctttcaacag |
301514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University