View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16962_low_3 (Length: 403)
Name: NF16962_low_3
Description: NF16962
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16962_low_3 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 170; Significance: 4e-91; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 170; E-Value: 4e-91
Query Start/End: Original strand, 194 - 391
Target Start/End: Original strand, 36006488 - 36006684
Alignment:
| Q |
194 |
atgtatcttcttctttttgttttgcatgtgataaccataccaaaagagagaagatacgttacaattttttccttagataattgcgtacaccgttggctcc |
293 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||| ||||| |||||||||| |||||||||||| |||||||||||||||||| |
|
|
| T |
36006488 |
atgtatcttcttctttttgttttgcatgtgataaccatac-aaaagagagaggatacattacaattttatccttagataatcgcgtacaccgttggctcc |
36006586 |
T |
|
| Q |
294 |
atgtaataacacaagatatttatttatagccaaattgcctctccataattcgtaaacttccgatgtgggattcaatttttgtgaccacccttaatttt |
391 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36006587 |
atgtaataacacaagatatttatttatagccaaattgcctctccataagtcgtaaacttccgatgtgggattcaatttttgtgaccacccttaatttt |
36006684 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 17 - 120
Target Start/End: Original strand, 36006309 - 36006413
Alignment:
| Q |
17 |
agtaaatgctagtacaatgactaggacaaaattattttacataggacaagtatggaccaatcctacggggcataaatttgattata-ttttggagaggag |
115 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| || ||||||||||||| |
|
|
| T |
36006309 |
agtaaatgctagtacaatgaccaggacaaaattattttacataggacaagtatggaccagtcctacggggcataaatttgattttatttttggagaggag |
36006408 |
T |
|
| Q |
116 |
gaacc |
120 |
Q |
| |
|
||||| |
|
|
| T |
36006409 |
gaacc |
36006413 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 316 - 365
Target Start/End: Original strand, 36011868 - 36011917
Alignment:
| Q |
316 |
tttatagccaaattgcctctccataattcgtaaacttccgatgtgggatt |
365 |
Q |
| |
|
|||||||||||||||||||| |||| ||| ||||||| || ||||||||| |
|
|
| T |
36011868 |
tttatagccaaattgcctcttcatatttcttaaactttcggtgtgggatt |
36011917 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University