View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16962_low_6 (Length: 269)
Name: NF16962_low_6
Description: NF16962
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16962_low_6 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 70 - 249
Target Start/End: Original strand, 38584185 - 38584364
Alignment:
| Q |
70 |
cctcaacaagtacttgatatggcaatgaaataatagtcaataaattttcttccctactatttttgggatgatgttgtgagataatattggtgattgtttg |
169 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38584185 |
cctcaacaagtacttgatatggcaatgaaataatagtcaataaattttcttccctactatttttgggatgatgttgtgagataatattggtgattgtttg |
38584284 |
T |
|
| Q |
170 |
gttcaagatttaaattataggtatgcattgacccatggcttctatgaaccgttgaggaaattcattggccatgtatatag |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38584285 |
gttcaagatttaaattataggtatgcattgacccatggcttctatgaaccgttgaggaaattcattggccatgtatatag |
38584364 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University