View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16962_low_7 (Length: 251)
Name: NF16962_low_7
Description: NF16962
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16962_low_7 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 14 - 237
Target Start/End: Original strand, 7568945 - 7569168
Alignment:
| Q |
14 |
atttgataattgcaggtatgattatgggtgcatcattgtcaactgtttactacaatttgaggcttagacacccagcactagacataccacttatagatta |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||| |||||||||||||||||| ||||||||||| ||||| |||||||||| |||||||||||||| |
|
|
| T |
7568945 |
atttgataattgcaggtatgattatgggtgcagcattatcaactgtttactacaatatgaggcttagaaacccaacactagacatgccacttatagatta |
7569044 |
T |
|
| Q |
114 |
tgatttggctttgcttttccagcctatgctgatgcttggaataagtattggagttgtttgtaatgtcatgtttgctgattggatggtcacagttttgctt |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7569045 |
tgatttggctttgcttttccagcctatgctgatgcttggaataagtattggagttatctgtaatgtcatgtttgctgattggatggtcacagttttgctc |
7569144 |
T |
|
| Q |
214 |
atcatcatattcataggtaatatt |
237 |
Q |
| |
|
|||||| |||| |||||||||||| |
|
|
| T |
7569145 |
atcatcttatttataggtaatatt |
7569168 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 98; Significance: 2e-48; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 22 - 235
Target Start/End: Complemental strand, 33126392 - 33126179
Alignment:
| Q |
22 |
attgcaggtatgattatgggtgcatcattgtcaactgtttactacaatttgaggcttagacacccagcactagacataccacttatagattatgatttgg |
121 |
Q |
| |
|
|||||||||||||||| || ||| | ||||||||| || |||||| ||||||||||||||||| |||||||||| |||||||||||||||||| | | |
|
|
| T |
33126392 |
attgcaggtatgattacaggagcagctgggtcaactgtgtattacaatctgaggcttagacacccaacactagacatgccacttatagattatgatcttg |
33126293 |
T |
|
| Q |
122 |
ctttgcttttccagcctatgctgatgcttggaataagtattggagttgtttgtaatgtcatgtttgctgattggatggtcacagttttgcttatcatcat |
221 |
Q |
| |
|
||||||| |||||||||||||| ||||| ||||| || ||||| |||| | ||||||||||||||||||||||||||| || ||||||||||||| | |
|
|
| T |
33126292 |
ctttgctcttccagcctatgctaatgctcggaattagcattggtgttgcatttaatgtcatgtttgctgattggatggttaccattttgcttatcattct |
33126193 |
T |
|
| Q |
222 |
attcataggtaata |
235 |
Q |
| |
|
|||||| ||||||| |
|
|
| T |
33126192 |
attcattggtaata |
33126179 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University