View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16964_high_5 (Length: 379)
Name: NF16964_high_5
Description: NF16964
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16964_high_5 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 115; Significance: 2e-58; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 256 - 374
Target Start/End: Complemental strand, 5596227 - 5596109
Alignment:
| Q |
256 |
tttcattgattttaaatacccaaaacctttctcttttccctcctttctgttgaatttaaatacccttttgttgattcttgatcaatcaagcaaaaagttc |
355 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5596227 |
tttcattgattttaaatacccaaaacctctctcttttccctcctttctgttgaatttaaatacccttttgttgattcttgatcaatcaagcaaaaagttc |
5596128 |
T |
|
| Q |
356 |
cctcctttttgttgatttt |
374 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
5596127 |
cctcctttttgttgatttt |
5596109 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 110 - 212
Target Start/End: Complemental strand, 5596378 - 5596271
Alignment:
| Q |
110 |
ttcaaaccatgaaaactttact----aaaccagggtacaaggaaccggg-aacttcactagggcatagggaagcgggaacctgaaagtaaacgatcttat |
204 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| || |||||||||| |
|
|
| T |
5596378 |
ttcaaaccatgaaaactttacttactaaaccagggtacaaggaaccggggaacttcactagggcatagggaagcgggaacctgaaaatatacgatcttat |
5596279 |
T |
|
| Q |
205 |
ccgattat |
212 |
Q |
| |
|
|||||||| |
|
|
| T |
5596278 |
ccgattat |
5596271 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University