View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16964_low_13 (Length: 204)
Name: NF16964_low_13
Description: NF16964
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16964_low_13 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 151; Significance: 4e-80; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 151; E-Value: 4e-80
Query Start/End: Original strand, 15 - 181
Target Start/End: Complemental strand, 6668620 - 6668454
Alignment:
| Q |
15 |
aatatgtaaatcatggaagaggataattatggagaaaataacaacaaactgatgcagagagatacatacattatctacacctgttagttatcgcatgaca |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
6668620 |
aatatgtaaatcatggaagaggataattatggagaaaataacaacaaactgatgcagagagatatatacattatctacacctgttagttatcgcatgaca |
6668521 |
T |
|
| Q |
115 |
ccaccttcagaacattcaagcttgttcttcattgattaatagcctaaaagttgaaattaaaattaag |
181 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
6668520 |
ccaccttcagagcattcaagcttgttcttcattatttaatagcctaaaagttgaaattaaaattaag |
6668454 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University