View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16964_low_2 (Length: 603)
Name: NF16964_low_2
Description: NF16964
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16964_low_2 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 145; Significance: 5e-76; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 145; E-Value: 5e-76
Query Start/End: Original strand, 409 - 590
Target Start/End: Original strand, 30316505 - 30316686
Alignment:
| Q |
409 |
gattattatgtaccgtattgtcttgtatatatgtggttgtccataaattatctcaaaataggtgtttaaataacacatctcaatcaaatataatattcta |
508 |
Q |
| |
|
|||||||||||||| ||||||||||| ||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30316505 |
gattattatgtaccatattgtcttgtgtatatgtggttgtccataaattatctcgaaatgggtgtttaaataacacatctcaatcaaatataatattcta |
30316604 |
T |
|
| Q |
509 |
aatttacaaaaatcaatgttaatatgaataaattttgcaaaactnnnnnnncaacaaccaacagaaacacaaagtcatatat |
590 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
30316605 |
aatttacaaaaatcaatgttaatatgaataaattttgcaaaactaaaaaaacaacaaccaacagaaacacaaagtcatatat |
30316686 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 94; E-Value: 1e-45
Query Start/End: Original strand, 38 - 139
Target Start/End: Original strand, 30316132 - 30316233
Alignment:
| Q |
38 |
tcataaatttttatatgtgagctctcagttatctattgtcatttcgtttatttatccaaataaagaggctctatgtttagttgagccttgcaaaattctc |
137 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
30316132 |
tcataaatttttatatgtgagctctcagttatctattgtcatttcgtttatttacccaaataaagaggctctatgtttagttgagccttgcaaagttctc |
30316231 |
T |
|
| Q |
138 |
gg |
139 |
Q |
| |
|
|| |
|
|
| T |
30316232 |
gg |
30316233 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 330 - 381
Target Start/End: Original strand, 30316426 - 30316477
Alignment:
| Q |
330 |
atcttttgacgacttatagaacaaccaaagatatgcatgcaaggcaacatgg |
381 |
Q |
| |
|
|||||||||| |||||||| ||||||||||||||||||| |||||||||||| |
|
|
| T |
30316426 |
atcttttgacaacttataggacaaccaaagatatgcatgtaaggcaacatgg |
30316477 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University