View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16964_low_8 (Length: 337)
Name: NF16964_low_8
Description: NF16964
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16964_low_8 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 170; Significance: 3e-91; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 170; E-Value: 3e-91
Query Start/End: Original strand, 148 - 321
Target Start/End: Original strand, 32598763 - 32598936
Alignment:
| Q |
148 |
tttaaggtggtagtaacataccaatctgatgggacatgtaaagaactccctcccatagttatttggagtatgagcggttttgagaagacaaacaccatga |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32598763 |
tttaaggtggtagtaacataccaatctgatgggacatgtaaagaactccctcccatagttatttggagtatgagcggttttgagaagacaaacaccatga |
32598862 |
T |
 |
| Q |
248 |
ccgcaaccacaccatatctgcttgtcggaagacaaaaccggtgaatggttgttgttcttgttgggggttttgag |
321 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32598863 |
ccgcagccacaccatatctgcttgtcggaagacaaaaccggtgaatggttgttgttcttgttgggggttttgag |
32598936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 11 - 87
Target Start/End: Original strand, 32598626 - 32598702
Alignment:
| Q |
11 |
caaaggacgctgaaaatcactctcatggatggtaccatcacaccacttaaaagtaccacaaggtttaccctaacaag |
87 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32598626 |
caaaggacgctgaaaatcactctcatggatggtaacatcacaccacttaaaagtaccacaaggtttaccctaacaag |
32598702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 235 - 309
Target Start/End: Original strand, 32603427 - 32603501
Alignment:
| Q |
235 |
acaaacaccatgaccgcaaccacaccatatctgcttgtcggaagacaaaaccggtgaatggttgttgttcttgtt |
309 |
Q |
| |
|
||||| ||| |||||||||| ||| ||| ||||||| |||||||||||||||||||||||| ||||| ||||| |
|
|
| T |
32603427 |
acaaaaaccgtgaccgcaacgacagtgtatttgcttgttggaagacaaaaccggtgaatggttattgttgttgtt |
32603501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 245 - 309
Target Start/End: Original strand, 31906206 - 31906270
Alignment:
| Q |
245 |
tgaccgcaaccacaccatatctgcttgtcggaagacaaaaccggtgaatggttgttgttcttgtt |
309 |
Q |
| |
|
|||||||||| ||| ||| ||||||| |||||||||||||||||||||||| ||||| ||||| |
|
|
| T |
31906206 |
tgaccgcaacgacagtgtatttgcttgttggaagacaaaaccggtgaatggttattgttgttgtt |
31906270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University