View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16965_high_10 (Length: 362)
Name: NF16965_high_10
Description: NF16965
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16965_high_10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 297; Significance: 1e-167; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 297; E-Value: 1e-167
Query Start/End: Original strand, 1 - 344
Target Start/End: Original strand, 15951391 - 15951732
Alignment:
| Q |
1 |
ctggtgtcgaaatttgagatgacttagattttgctgccaccggtttcttctttgttttagctgcattattttccctgttcacagggataacctatccaaa |
100 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
15951391 |
ctggtgtcgaaatttgagatgccttagattttgctgccaccggtttcttctttgttttggctgcattattttccctattcacagggataacctatccaaa |
15951490 |
T |
 |
| Q |
101 |
ataaacggtaatcaaatactcaacctttaagaaatttaacattgcgaatacatatgatttaaccaaatacgaaataaagcaaaccttagatttatttgga |
200 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||| ||||| |||||||||| |||||| ||| |||||||||||||||||||||||||| |
|
|
| T |
15951491 |
ataaacggtaatcaaatactcaacgtttaagaaatttaacattatgaata--tatgatttaatcaaatatgaattaaagcaaaccttagatttatttgga |
15951588 |
T |
 |
| Q |
201 |
tgatccaatttcacatctttttcttcaacttgtgaagccttttctgtctctttgtacacaacatgtgaaatttccttcacatcttcagcttcaacgtcaa |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15951589 |
tgatccaatttcacatctttttcttcaacttgtgaagccttttctgtctctttgtacacaacatgtgaaatttccttcacatcttcagcttcaacgtcaa |
15951688 |
T |
 |
| Q |
301 |
gaatttcttctagttttatgcacacatcttttacaggctcgtct |
344 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15951689 |
gaatttcttctagttttatgcacacatcttttacaggctcgtct |
15951732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 3 - 40
Target Start/End: Original strand, 15951354 - 15951391
Alignment:
| Q |
3 |
ggtgtcgaaatttgagatgacttagattttgctgccac |
40 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
15951354 |
ggtgtcgaaatttgagatgccttagattttgctgccac |
15951391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University