View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16965_high_12 (Length: 343)
Name: NF16965_high_12
Description: NF16965
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16965_high_12 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 81 - 342
Target Start/End: Complemental strand, 10221471 - 10221220
Alignment:
| Q |
81 |
tggtgtgcattctttgagtcgtgtcttgcacacattgttatttctatattctttactttgatcatctttgtccccacaaatacttggtttacctatttgt |
180 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
10221471 |
tggtgtgcattctttgagtcgtgtcttgcacacattgttatgtctatattctttactttgatcatctttgtccccacaaatact----------atttgt |
10221382 |
T |
 |
| Q |
181 |
tgcatcatgtattgtctcaagaattggtcctacaaaattgtattaaatcaacttccaatgattttactctaacaggtggaaccagctgttgaggtctacc |
280 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10221381 |
tgcatcatgtattgtctcaagaattggtcctacaaaattgtattaaatcaacttccaatgattttactctaacaggtggaaccagctgttgaggtctacc |
10221282 |
T |
 |
| Q |
281 |
atgacaaggaatatagatcaaagatatggaaattcccctctcacaacttcacactctcagta |
342 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10221281 |
atgacaaggaatatagatcaaagatatggaaattcccctctcacaacttcacactctcagta |
10221220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University