View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16965_high_17 (Length: 329)
Name: NF16965_high_17
Description: NF16965
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16965_high_17 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 265; Significance: 1e-148; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 265; E-Value: 1e-148
Query Start/End: Original strand, 16 - 284
Target Start/End: Complemental strand, 40752785 - 40752517
Alignment:
| Q |
16 |
ctataaacaatatctacagcaccctcatctaccatattccacacatggatgattcttcttctgcagctgaagacaccaagagttgtccacgtggtcactg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40752785 |
ctataaacaatatctacagcaccctcatctaccatattccacacatggatgattcttcttctgcagctgaagacaccaagagttgtccacgtggtcactg |
40752686 |
T |
|
| Q |
116 |
gcgacccgccgaagatgaaaaacttcgtcaacttgttgaacaatatggtgcccaaaattggaattcaattgctgaaaaactccaaggaagatcaggtatg |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40752685 |
gcgacccgccgaagatgaaaaacttcgtcaacttgttgaacaatatggtgcccaaaattggaattcaattgctgaaaaactccaaggaagatcaggtatg |
40752586 |
T |
|
| Q |
216 |
tattatgcaataatattaattaaagctttattattaattgatttagtttggggagtgcttgctgctgtt |
284 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
40752585 |
tattatgcaataatattaattaaagctttattattaattgattttgtttggggagtgcttgctgctgtt |
40752517 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University