View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16965_low_11 (Length: 362)

Name: NF16965_low_11
Description: NF16965
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16965_low_11
NF16965_low_11
[»] chr5 (2 HSPs)
chr5 (1-344)||(15951391-15951732)
chr5 (3-40)||(15951354-15951391)


Alignment Details
Target: chr5 (Bit Score: 297; Significance: 1e-167; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 297; E-Value: 1e-167
Query Start/End: Original strand, 1 - 344
Target Start/End: Original strand, 15951391 - 15951732
Alignment:
1 ctggtgtcgaaatttgagatgacttagattttgctgccaccggtttcttctttgttttagctgcattattttccctgttcacagggataacctatccaaa 100  Q
    ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||    
15951391 ctggtgtcgaaatttgagatgccttagattttgctgccaccggtttcttctttgttttggctgcattattttccctattcacagggataacctatccaaa 15951490  T
101 ataaacggtaatcaaatactcaacctttaagaaatttaacattgcgaatacatatgatttaaccaaatacgaaataaagcaaaccttagatttatttgga 200  Q
    |||||||||||||||||||||||| ||||||||||||||||||  |||||  |||||||||| |||||| ||| ||||||||||||||||||||||||||    
15951491 ataaacggtaatcaaatactcaacgtttaagaaatttaacattatgaata--tatgatttaatcaaatatgaattaaagcaaaccttagatttatttgga 15951588  T
201 tgatccaatttcacatctttttcttcaacttgtgaagccttttctgtctctttgtacacaacatgtgaaatttccttcacatcttcagcttcaacgtcaa 300  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
15951589 tgatccaatttcacatctttttcttcaacttgtgaagccttttctgtctctttgtacacaacatgtgaaatttccttcacatcttcagcttcaacgtcaa 15951688  T
301 gaatttcttctagttttatgcacacatcttttacaggctcgtct 344  Q
    ||||||||||||||||||||||||||||||||||||||||||||    
15951689 gaatttcttctagttttatgcacacatcttttacaggctcgtct 15951732  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 3 - 40
Target Start/End: Original strand, 15951354 - 15951391
Alignment:
3 ggtgtcgaaatttgagatgacttagattttgctgccac 40  Q
    ||||||||||||||||||| ||||||||||||||||||    
15951354 ggtgtcgaaatttgagatgccttagattttgctgccac 15951391  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University