View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16965_low_17 (Length: 330)
Name: NF16965_low_17
Description: NF16965
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16965_low_17 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 147; Significance: 2e-77; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 147; E-Value: 2e-77
Query Start/End: Original strand, 150 - 321
Target Start/End: Original strand, 41628002 - 41628175
Alignment:
| Q |
150 |
gtatcaactatgattgacataaatggttgaacttccaa--cacaaacattttcatggtaaattttcaatgaggttgacgatgaccatgcatacggtaaat |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| || ||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
41628002 |
gtatcaactatgattgacataaatggttgaactttcagttcacaaacattttcattgtaaatttttaatgaggttgacgatgaccatgcatacggtaaat |
41628101 |
T |
 |
| Q |
248 |
tgaatttaaagatacatttatctatagatctcttttaattgtttgactaataacttttcttagtcttcctttgc |
321 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41628102 |
tgaatttaaagatacatttatctatagatctcttttaattgtttgactaataacttttcttagtcttcctttgc |
41628175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 1 - 43
Target Start/End: Original strand, 41627915 - 41627957
Alignment:
| Q |
1 |
aaaattattgaattttgttgtctaaagttgatgctcaaataac |
43 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41627915 |
aaaattattgaattttgttgtctaaagttgatgctcaaataac |
41627957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University