View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16967_high_17 (Length: 350)
Name: NF16967_high_17
Description: NF16967
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16967_high_17 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 111; Significance: 6e-56; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 111; E-Value: 6e-56
Query Start/End: Original strand, 1 - 161
Target Start/End: Complemental strand, 36490124 - 36489966
Alignment:
| Q |
1 |
tttggagggaatgacagtggacacgtgaaaaaactgcttctgttttgtcnnnnnnnnnnnctttcgtcttttggtccatgccctctttgtcctgtcaaaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36490124 |
tttggagggaatgacagtggacacgtgaaaaaactgcttctgttttgtcttttttttt--ctttcgtcttttggtccatgccctctttgtcctgtcaaaa |
36490027 |
T |
 |
| Q |
101 |
actagtagctttgccaagcatatcataatcataattactgcagctgtgaaaacaaggtagc |
161 |
Q |
| |
|
||||||| ||||| ||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
36490026 |
actagtacctttgacaagcatatcataatcataattactgcagttgtgaaaacaaggtagc |
36489966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 328
Target Start/End: Complemental strand, 36489709 - 36489657
Alignment:
| Q |
276 |
aaacatcagagtctattcaaatagtataactaaagaacttctatgatacacct |
328 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
36489709 |
aaacatcagagtgtattcaaatagtataactaaagaacttctatggtacacct |
36489657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University