View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16967_high_18 (Length: 349)
Name: NF16967_high_18
Description: NF16967
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16967_high_18 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 121; Significance: 6e-62; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 121; E-Value: 6e-62
Query Start/End: Original strand, 5 - 150
Target Start/End: Original strand, 40410910 - 40411051
Alignment:
| Q |
5 |
tcaacatcatcttgacaatattaataatatcagttagctacatatactatctctgacaacggataaaaggtatgatctaacttagaacatatatacttcc |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
40410910 |
tcaacatcatcttgacaatattaataatatcagttagctacatatactacctctgacaacggataaaaggtatgatctaacttagaac----atacttcc |
40411005 |
T |
|
| Q |
105 |
atatattattgccctcccaactattaaatcattgagatggcaacat |
150 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
40411006 |
atatattattgccctcccaactattaaatcatagagatggcaacat |
40411051 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 250 - 338
Target Start/End: Original strand, 40411527 - 40411612
Alignment:
| Q |
250 |
ataattgcttgccgaatactactgctagtacaaagtgtacaaccttgttacatgatatatataagctgaatacgtacgttgtccttcat |
338 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
40411527 |
ataattgcttgccgaatactact---agtacaaagtgtacaaccttgttacatgatatatataaactgaatacgtacgttgtccttcat |
40411612 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University