View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16967_high_32 (Length: 277)
Name: NF16967_high_32
Description: NF16967
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16967_high_32 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 99; Significance: 6e-49; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 92 - 259
Target Start/End: Original strand, 4068286 - 4068436
Alignment:
| Q |
92 |
atgaagaacaccggtatcaaactagcataacatgcaaaagatacaccaacttaacaagctactcaagtgttaatagtctctaacaaaccttgcattgctt |
191 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||| |
|
|
| T |
4068286 |
atgaaaaacaccggtatcaaactagcataacatgcaaaagatacaccaacttaacaagctactc----------------taacaa-ccttgcattgctt |
4068368 |
T |
|
| Q |
192 |
ccaaaaacacaaaccaccttctgaagctttcattgtggcttcaaaccaaggctccaacaccaattaca |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
4068369 |
ccaaaaacacaaaccaccttctgaagctttcattttggcttcaaaccaaggctccaacaccaattaca |
4068436 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 1 - 102
Target Start/End: Original strand, 4068137 - 4068238
Alignment:
| Q |
1 |
tcatcggtagcttttcattctttctgtaattaactgaattttattaatcaaaacccaaaaggaaggacaaacacgggtacaatgttcaaacatgaagaac |
100 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4068137 |
tcatcggtagcttttcattcttgctgtaattaactgaattttattaatcaaaacccaaaaggaaggacaaacacgggtacaatgttcaaacatgaagaac |
4068236 |
T |
|
| Q |
101 |
ac |
102 |
Q |
| |
|
|| |
|
|
| T |
4068237 |
ac |
4068238 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University