View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16967_low_23 (Length: 334)
Name: NF16967_low_23
Description: NF16967
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16967_low_23 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 281; Significance: 1e-157; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 281; E-Value: 1e-157
Query Start/End: Original strand, 18 - 323
Target Start/End: Complemental strand, 34388719 - 34388414
Alignment:
| Q |
18 |
tttttaacgttgtttttcttacaaacatgtgccgttttattaactagaccataaactttccatgtgtcgtnnnnnnncaaattttgtgacatgttatgga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
34388719 |
tttttaacgttgtttttcttacaaacatgtgccgttttattaactagaccataaactttccatgtgtcgtaaaaaaacaaattttgtgacatgttatgga |
34388620 |
T |
 |
| Q |
118 |
aagaatatttgttatgttgttatcatcttccacgcaataccatgaacatgaacctgccattttctcttccctaagatgtactatgaaacccttctctctc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34388619 |
aagaatatttgttatgttgttatcatcttccacgcaataccatgaacatgaacctgccattttctcttccctaagatgtactatgaaacccttctctctc |
34388520 |
T |
 |
| Q |
218 |
ttgtctcaaacacagaaattatacagttcatagtttttccaatctcacattgcaacaatattgaaatttgaagccttaagattttgaatctcattttttg |
317 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34388519 |
ttgtctcaaacacagaaattatacagttcatagtttttctaatctcacattgcaacaatattgaaatttgaagccttaagattttgaatctcattttttg |
34388420 |
T |
 |
| Q |
318 |
tttctt |
323 |
Q |
| |
|
|||||| |
|
|
| T |
34388419 |
tttctt |
34388414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University