View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16967_low_25 (Length: 330)
Name: NF16967_low_25
Description: NF16967
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16967_low_25 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 175; Significance: 3e-94; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 131 - 317
Target Start/End: Complemental strand, 4609142 - 4608956
Alignment:
| Q |
131 |
tagcctctgaagaaagtttgaatctttacagcagcccatttctctctacttccactgaacaatgtacctctaccttgacttgtcaacctcacaactgcca |
230 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
4609142 |
tagcctctgaagaaagtttgaatctttacagcagcccatttctctctacttccactgaacaatgtacctctaccttgacttgtcagcctcacaactgcca |
4609043 |
T |
 |
| Q |
231 |
cggcagcctgcgcggcggccacagcagcatccgcagcggccgccgtagcagctgcaacagcaattgcatgtttgttctgttgatttt |
317 |
Q |
| |
|
|||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4609042 |
cggcagcctgtgcggcggccacagcagcatcagcagcggccgccgtagcagctgcaacagcaattgcatgtttgttctgttgatttt |
4608956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University