View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16967_low_33 (Length: 303)
Name: NF16967_low_33
Description: NF16967
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16967_low_33 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 21 - 247
Target Start/End: Complemental strand, 3424121 - 3423895
Alignment:
| Q |
21 |
atcgaaacttctactcaacgtgtccatcgagaacacgttgggtgcaatacaagttttgatgttgcctgaagataccgttggccaattagtgaaggttgca |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3424121 |
atcgaaacttctactcaacgtgtccatcgagaacacgttgggtgcaatacaagttttgatgttgcctgaagataccgttggccaattagtgaaggttgca |
3424022 |
T |
 |
| Q |
121 |
ttgatgacttatgataaggagaagagaaggccgttattgaaggacaccgatccaaaccgctaccaacttcactactctccgttcacgcttgaaagtaatt |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
3424021 |
ttgatgacttatgataaggagaagagaaggccgttattgaaggacaccgatccaaaccgctaccaacttcactactctccgttcacgctggaaagtaatt |
3423922 |
T |
 |
| Q |
221 |
atgttaaccttaatccttcaatgttcc |
247 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
3423921 |
atgttaaccttaatccttcaatgttcc |
3423895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University